Myelodysplastic syndromes (MDS) are among the most common myeloid malignancies.1 They encompass a spectrum of clonal bone marrow (BM) failure diseases characterized by ineffective hematopoiesis and progression to acute myeloid leukemia (AML).2 The clinical course of MDS varies widely from indolent, requiring only monitoring/supportive care, to aggressive disease with AML-like biology.1 Recurrent somatic mutations contribute to the pathophysiology, being recently incorporated into prognostic scoring systems.2,3 Akin to targeted therapy in AML, somatic mutations might be therapeutically targeted in MDS. Unfortunately, testing this hypothesis has been challenging due to the lack of preclinical models that truly recapitulate disease biology, particularly in lower-risk disease. This limitation has resulted in a dearth of novel targeted therapeutics and slow drug development in the field.4
Genetically engineered mouse models of recurrent somatic mutations present in MDS hold promise for advances in understanding the biology of these diseases. However, given that introns are generally not conserved between mice and humans, there is potential for significant differences in intron retention and cryptic splicing between human and mouse hematopoietic cells bearing spliceosome mutations.4 The lack of readily available patient-derived xenograft (PDX) models remains the major barrier to drug development. NSG/NSG-S mice lack functional B, T, and natural killer cells as well as immunoglobulins,5 and are unreliable for establishing PDX of low-risk MDS.4 Our previous experience with conditioning regimens based exclusively on radiotherapy did not result in engraftment of MDS cells (data not shown). Recently, PDX models of MDS based on intra-bone co-injection of human mesenchymal stromal cells6 or subcutaneous generation of ossicles using human mesenchymal stromal cells7 have mitigated this shortcoming. Moreover, intra-hepatic injection of OKT3-depleted MDS BM into double-irradiated newborn MISTRG mice resulted in robust and reliable engraftment.8 However, these models are not widely available and require technical skills that reduce their utility. It would, therefore, be opportune to develop a PDX model that is more suitable for testing novel targeted therapies and that allows for high throughput drug screening in low-risk diseases.
MISTRG mice are similar to other xenograft models in the sense that they are immunocompromised and express human cytokines (knocked-in in the case of MISTRG mice). Nevertheless, one key feature of MISRTG mice is their expression of human SIRPα. Their ability to recognize human CD47 (the “don’t eat me” signal) may explain the more reliable engraftment of human cells in these mice.9 One way to reproduce this feature in NSG/NSG-S mice is by depleting macrophages with clodronate. Intraperitoneal administration of 100 μL of clodronate liposomes (Form-uMax) to 6- to 8-week-old mice (NOD.Cg-PrkdcscidIl2rgtm1Wjl/NSG-Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySz J-NSG-S, prior to Jackson Laboratories; Jackson Laboratories), led to an 83% reduction of macrophages in the BM, and >99% reduction in the spleen after 48 h (Online Supplementary Figure S1A, B). The depletion persisted 7 days later, with 97% reduction in the BM, and still >99% in the spleen (Online Supplementary Figure S1A, B). In contrast, administration of 2 Gy of radiotherapy (classically used for conditioning) did not affect the presence of macrophages in the BM or spleen (Online Supplementary Figure S1A, B). To test whether depletion of macrophages enabled engraftment of patient-derived MDS cells, we conditioned 6- to 8-week-old NSG/NSG-S mice with 100 μL of clodronate liposomes, on day -2 and irradiated them with 2 Gy on day 0. Six hours later, we injected CD34+ cells, via the tail vein; the cells were selected, as previously published,7 from the BM of a patient with low-risk MDS (Figure 1A). At the time of sample collection, the patient had 1-2% CD34+ blasts (Table 1). The BM samples came from MDS patients who had consented to participate in this study in accordance with the Declaration of Helsinki. The research protocol was approved by the Johns Hopkins Institutional Review Board. Flow-cytometry analysis of peripheral blood collected from transplanted mice 1, 2, and 3 months after transplantation showed the presence of human leukocytes (mouse CD45–[mCD45–] human CD45+ [hCD45+]) (Figure 1B). At 3 months after transplantation, NSG mice showed reliable engraftment in the BM (Online Supplementary Figure S1C). NSG-S mice demonstrated consistent engraftment in the peripheral blood, spleen, and BM (Online Supplementary Figure S1C, Table 1). Furthermore, NSG-S mice showed detectable CD34+ leukocytes (mCD45–hCD45+hCD34+) as well as human erythroid cells (mCD45–hCD45–glycophorin A+ [GPA+]) in the BM at 3 months after transplantation. Using hCD45 beads and a magnetic column (Miltenyi), we selected hCD45+ cells from the BM of these mice. hCD45+ cells were pooled together and DNA was extracted using the Quick-DNA Miniprep Plus kit (Zymo Research). Libraries were prepared using a xGen Prism DNA Library Prep Kit (IDT) and IDT hybridization capture-based targeted duplex sequencing was done on a NOVASeq6000 platform in an SP flow cell. Data analyzed using DRAGEN Enrichment (v4.0.3) showed that the selected hCD45+ cells had a similar clonal architecture to that of the transplanted CD34+ cells and the clinical samples (Figure 2A). Secondary transplantation using 106 hCD45+ cells isolated from the BM of NSG/NSG-S mice resulted in detectable human engraftment, albeit at lower levels compared to those in primary recipients (data not shown).
We tested the reproducibility of the NSG-S model using various conditions: different CD34+ numbers, fresh versus frozen cells and clinical specimens from low-risk MDS patients with different molecular profiles (Table 1). Human leukocytes were present in the peripheral blood of all mice at 1 (0.52%-14%) and 3 months (3.1%-20.7%) after transplantation (Table 1). Similarly, we observed successful engraftment in the BM (18.1%-99.3%) and spleen (8.1%-31.3%) at 3-6 months after transplantation (engraftment levels for each individual mouse are shown in Online Supplementary Figure S1C). Human cells were mostly CD33+ myeloid cells (38.2%-90.7% of hCD45+ cells). B-cell engraftment, as detected by the presence of CD19+/CD20+ cells (0.11%-2.1% of hCD45+) was present in a subset of animals. No mice showed CD3+ T- cell engraftment. Human erythroid engraftment is particularly difficult to achieve in xenograft models, as erythroid precursor cells are constantly removed by host macrophages. The depletion of macrophages with clodronate resulted in erythropoietic cell engraftment including hCD45–hCD71+ and hCD45–hCD71+GPA+ cells in the BM and spleen of recipient mice (Figure 1B, Table 1). In addition, hCD45+hCD41+ (0.14%-0.47% of hCD45+) and hCD45–hCD41+ (0.1%-0.63% of mCD45–hCD45–) megakaryocyte lineage cells were present in the BM and spleen.
The clonal architecture of engrafted cells recapitulated that of the clinical BM samples and enriched CD34+ cells (Figure 2A, B, D). In lieu of morphological analysis of engrafted human cells, we investigated whether these cells showed preserved cryptic intron retention, similarly to the original sample. To this end, we extracted mRNA (from the pooled hCD45+ cells sorted from the mouse BM) using the Monarch Total RNA Miniprep Kit and synthesized cDNA with the High-Capacity cDNA Reverse Transcription Kit in order to do splicing assays of the samples with mutated splicing factors (SF3B1 and ZRSR2). For the SF3B1 splicing assay, an isoform-competitive endpoint polymerase chain reaction for canonical cryptic acceptors in exon 2 of TMEM14C was performed with the primers GACACCTCGCAGTCATTCCT and TGATCCCACCAGAAGCAACC. For the ZRSR1 splicing assay, quantitative polymerase chain reaction was performed using the KAPA SYBR FAST qPCR Master Mix (2X) Kit with the primers CCCGCTCCAGCTACTTTGAA and CAAACAAGTA-GAGCGAGTCCT for canonical LZTR1 and primers CCCGCTCCAGCTACTTTGAA and AGTTCACTGGGGAGTGAG-GAT for LZTR1 intron 18 retention. The expression ratio was calculated with 2^-(canonical cycle threshold–cryptic cycle threshold). mRNA analysis of engrafted MDS cells with SF3B1 (patient 2) and ZRSR2 (patient 3) mutations validated the persistence of physiologically impactful10,11 mis-splicing events in TMEM14C and LZTR1, respectively (Figure 2C, E). For further exploration of disease relevance, after confirming engraftment, PDX derived from patient 3 were treated with either azacitidine (5 daily injections of 5 mg/kg, 2 cycles, 4 weeks apart) or saline. PDX treated with azacitidine showed decreased levels of BM engraftment at 6 months after transplantation (4 weeks after the completion of the 2nd cycle) (Table 1). Although not definitive (because of the small number of mice), these results serve as proof of concept of the model’s applicability to study therapeutic interventions.
Recent years have seen the emergence of new technologies for augmentation of murine modeling of MDS, including genetically engineered mouse models and innovative PDX models. The PDX model described here complements currently available analytic tools in MDS. It makes use of relatively inexpensive and widely available reagents (i.e., NSG-S mice, clodronate, and radiation) and engraftment is tracked via non-invasive methods. Given the simplicity of its workflow, with no need for other moving parts (e.g., timed pregnancies, pre-engraftment of other cell populations or bone fragments), the use of vi-ably frozen CD34+ cells and easy conditioning regimen followed by intravenous injection, this model is suitable for large-scale drug testing in low-grade MDS. Typically, 20-30 mL of BM aspirate from a low-grade MDS sample may be sufficient to generate 50-60 PDX mice. Such scaling allows for testing of single-agent regimens (e.g., spliceosome inhibitors) and combination therapies (e.g., with hypomethylating agents) thus informing early-stage clinical development.
Footnotes
- Received March 6, 2023
- Accepted June 29, 2023
Correspondence
Disclosures
CG has received research support from Menarini Ricerche, Abbie, Inc. and serves on an advisory board for Syros, Inc. WBD has received research support from Abbvie, Inc.
Contributions
PT wrote the manuscript, performed research, and analyzed data. SP analyzed sequencing data. IC designed, performed and analyzed the intron retention experiments. SC performed library preparation for sequencing experiments. WBD designed, performed and analyzed the splicing experiments. LPG designed, performed and analyzed the sequencing experiments. AED contributed patients’ samples. GG designed the project. All authors critically reviewed the manuscript.
Data-sharing statement
The essential data supporting our findings are present within the article and Online Supplementary Material. The corresponding author can, upon reasonable request, provide raw data and additional details. All shared data will be anonymized for privacy.
Funding
References
- Zeidan AM, Shallis RM, Wang R, Davidoff A, Ma X. Epidemiology of myelodysplastic syndromes: why characterizing the beast is a prerequisite to taming it. Blood Rev. 2019; 34:1-15. Google Scholar
- Sperling AS, Gibson CJ, Ebert BL. The genetics of myelodysplastic syndrome: from clonal haematopoiesis to secondary leukaemia. Nat Rev Cancer. 2017; 17(1):5-19. Google Scholar
- Bernard E, Tuechler H, Greenberg PL. Molecular International Prognostic Scoring System for myelodysplastic syndromes. NEJM Evidence. 2022; 1(7)Google Scholar
- Liu W, Teodorescu P, Halene S, Ghiaur G. The coming of age of preclinical models of MDS. Front Oncol. 2022; 12:815037. Google Scholar
- Shultz LD, Lyons BL, Burzenski LM. Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. J Immunol. 2005; 174(10):6477-6489. Google Scholar
- Medyouf H, Mossner M, Jann JC. Myelodysplastic cells in patients reprogram mesenchymal stromal cells to establish a transplantable stem cell niche disease unit. Cell Stem Cell. 2014; 14(6):824-837. Google Scholar
- Altrock E, Sens-Albert C, Jann JC. Humanized three-dimensional scaffold xenotransplantation models for myelodysplastic syndromes. Exp Hematol. 2022; 107:38-50. Google Scholar
- Song Y, Rongvaux A, Taylor A. A highly efficient and faithful MDS patient-derived xenotransplantation model for pre-clinical studies. Nat Commun. 2019; 10(1):366. Google Scholar
- Rongvaux A, Willinger T, Martinek J. Development and function of human innate immune cells in a humanized mouse model. Nat Biotechnol. 2014; 32(4):364-372. Google Scholar
- Clough CA, Pangallo J, Sarchi M. Coordinated missplicing of TMEM14C and ABCB7 causes ring sideroblast formation in SF3B1-mutant myelodysplastic syndrome. Blood. 2022; 139(13):2038-2049. Google Scholar
- Inoue D, Polaski JT, Taylor J. Minor intron retention drives clonal hematopoietic disorders and diverse cancer predisposition. Nat Genet. 2021; 53(5):707-718. Google Scholar
Data Supplements
Figures & Tables
Article Information
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.