Cryptic chromosome 9q34 deletion generates TAF-Iα/CAN and TAF-Iβ/CAN fusion transcripts in acute myeloid leukemia

Abstract

In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5′ TAF-I to the 3′ CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-Iα or TAF-Iβ moieties. We set up molecular assays to monitor the chimeric TAF-Iα/CAN and TAF-Iβ/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.

Chromosome rearrangements are diagnostic and prognostic markers which serve to classify acute myeloid leukemia (AML) into categories with specific clinical and hematologic features and to orienteer therapeutic choices. In 40–50% of AML with normal karyotype, FLT3 and NPM1 gene mutations are frequent and molecular cytogenetics have occasionally detected cryptic chromosome changes and genomic rearrangements. In a patient with AML-M4 with normal karyotype, and no FLT3 or NPM1 gene mutations we identified a cryptic interstitial del(9)(q34) during interphase fluorescence in situ hybridization (FISH) screening for the BCR/ABL1 fusion. del(9)(q) has been reported as an isolated cytogenetic abnormality or in association with t(8;21)(qq2;q22) in AML;1 cryptic del(9)(q34) has been found at the t(9;22)(q34;q11) translocation breakpoint in chronic myeloid leukemia (CML).2 Here we demonstrate for the first time that a cryptic del(9)(q34) produces a TAF-I/CAN fusion gene.

The CAN gene (also known as NUP214, nuclear pore complex protein 214kDa), mapping at chromosome 9q34, encodes a nucleoporin that participates in nucleocytoplasmic transport through interactions with import/ex port proteins such as hCRM1 and TAP/NFX1.3 TAF-1 (template activating factor-I) is a multi-tasking phosphoprotein involved in chromatin modeling, transcription, cell cycle control and protein phosphatase 2A inhibition.4–7 TAF-I transcribes two isoforms, TAF-Iα and TAF-Iβ, which bear different N-terminal sequences since they are transcribed from alternative first exons. As they homo-and hetero-dimerize, TAF-Iα and TAF-Iβ might modulate overall TAF-Iβ activity.8 Different levels of TAF-Iα and TAF-Iβ expression have been observed in various tissues and hematopoietic cell lines suggesting that their expression is tissue and cell-type specific.9 Moreover, functional assays on native and recombinant proteins indicate that TAF-Iα mediates chromatin remodeling more weakly than does TAF-Iβ.4 As part of the endoplasmic reticulum-associated SET complex, TAF-Iβ is cleaved by granzyme A during cytotoxic T-lymphocyte-mediated apoptosis.10

Design and Methods

Case report

A 35-year old man was admitted to our Department because of asthenia, arthralgia, and persistent fever. Clinical examination revealed an enlarged liver. Peripheral blood counts were: hemoglobin 7.9 g/dL, platelets 61×10/L, white blood cells 40×10/L with 90% blasts. Acute myelomonocytic leukemia (AML M4 according to the French-American-British classification) was diagnosed from a bone marrow aspirate. Immunophenotyping was positive for myeloperoxidase, CD34, CD33, CD13, CD45, CD66b, CD15 and CD11b antigens. The karyotype was normal. Sequencing of the FLT3 gene did not show any internal tandem duplications or activating loop mutations. NPM1 exon 12 was normal as assessed by denaturing high-Performance liquid chromatography. 11

The patient received daunorubicin and cytosine arabinoside as induction therapy and achieved remission according to hematologic parameters (<5% blasts on bone marrow smears) and FISH analysis (1.4% of nuclei with one fluorescence signal for ABL1 which is within the cut-off established in our laboratory for ABL1 monosomy/deletion in ten healthy controls). Reverse transcriptase polymerase chain reaction (RT-PCR) detected residual TAF-I/CAN positive clones (data not shown). Four months after diagnosis, the patient underwent hematopoietic stem cell transplantation from his HLA-identical brother.

Fluorescence in situ hybridization

FISH was performed according to previously published protocols.12 The BCR/ABL rearrangement was studied with the LSI BCR/ABL Dual Color, Single Fusion probe (Vysis). A panel of 22 DNA clones was applied to delineate the 9q34 deletion (Figure 1).

Figure 1.Molecular cytogenetic studies. (A) Array CGH: profile of chromosome 9 shows deletion of clones RP11-98H3 and RP11-17O4. (B) FISH experiments were done with a panel of 22 DNA clones selected for the 9q34 band. (C) Dual color FISH shows hybridization of clones RP11-550J21 (green) and RP11-143H20 (red) to only one chromosome 9. (D) Dual color FISH with clones RP11-216B9 (green) and RP11-544A12 (red) shows signals on both chromosomes 9.

Array comparative genomic hybridization (CGH)

The patient’s sample was hybridized to the SpectralChip 2600 BAC Array (Spectral Genomics) following the manufacturer’s instructions. Fluorescent signals were acquired with a GenePix 4000B scanner (Axon Instruments, Union City, CA, USA) running a GenePix Pro 6.0 software (Axon Instruments). Data were analyzed using SpectralWare™ BAC Array Analysis Software (Spectral Genomics).

Polymerase chain reaction

Bone marrow samples were obtained at diagnosis, after induction therapy, and at 14, 19, and 24 months after the HLA identical transplant. RNA and DNA extraction and cloning were done as already described.13 The TAF-I(SET)/CAN fusion transcripts were amplified using the following primer pairs: SET_540F (GAAGAGGCAGCATGAGGAAC) + CAN_2916R (TACTTTGGGCAAGGATTTGG), 643 bp; SET_540F + CAN_2705R (CGATTGTTGGCTAGGGTGTT) 432 bp; SET_87F (GCAAGAAGCGATTGAACACA) + CAN_2916R, 1096 bp. Isoform-specific PCR were performed with the common reverse primer CAN_2601R (ATCATTCACATCTTGGACAGCA) and either TAFIa_42F (GAAACCAAGACCACCTCCTG) for the TAF-Iα isoform, or TAFIb_38F (AGCTCAACTCCAACCACGAC) for TAF-Iβ. Del(9)(9) genomic breakpoints were amplified from 100 ng of the patient’s DNA with primers SET_747F (TGACGAAGAAGGGGATGAGGAT) and CAN_IN17_2R (CTGAGGCATTCAATTAAGTATGTC).

For nested PCR, the first amplification round was performed using primers SET_540F and CAN_2916R. The second round of amplification was performed with primers SET_747F and CAN_2601R. GAPDH (positive control) was amplified with primers GAPD247F (AATCCCATCACCATCTTCCA) and GAPD1147R (AGGGGAGATTCAGTGTGGTG).

Results and Discussion

A DNA probe used to study the BCR/ABL1 rearrangement in our patient with AML M4 did not detect a BCR/ABL1 fusion but gave an atypical hybridization pattern of one red and two green signals in 85% of nuclei, indicating an ABL1 monoallelic loss. The other 15% of nuclei had a normal hybridization pattern. Array CGH confirmed loss of genomic material from chromosome 9q34.1 (clones RP11-98H23 and RP11-17O4, Figure 1A). No other genomic imbalances were identified. Metaphase FISH with a panel of 22 DNA clones for the 9q arm showed the deleted region was flanked by clone RP11-216B9, containing the 5′-end of TAF-I, and clone RP11-544A12, containing the 3′-end of CAN (Figure 1B). The intervening sequence, which included the 3′ region of TAF-1 (RP11-550J21) and the 5′ region of CAN (RP11-143H20), was lost (Figure 1C–D), suggesting that a 2.5 Mb cryptic deletion at 9q34 juxtaposed TAF-1 and CAN. RT-PCR on a bone marrow sample obtained at diagnosis amplified a TAF-I/CAN fusion transcript joining TAF-I exon 7 with CAN exon 18 (Figure 2A, B). Isoform-specific RT-PCR detected TAF-Iα/CAN and TAF-Iβ/CAN chimeric transcripts (data not shown). Long-range PCR on the patient’s genomic DNA identified breakpoints at TAF-1 intron 7 and CAN intron 17 (Figure 3). After induction therapy nested RT-PCR detected residual TAF-I/CAN-expressing clones which were no longer detected after hematopoietic stem cell transplantation from the patient’s HLA-identical brother (data not shown). At a follow-up of 24 months, the patient is still in hematologic, FISH and molecular remission.

Figure 2.Amplification of TAF-I(SET)/CAN fusion cDNA. (A) Agarose gel electrophoresis of TAF-I/CAN fusion transcripts amplified by RT-PCR with the following primer pairs: SC1, SET_540F + CAN_2916R, 643 bp; “SC2”, SET_540F + CAN_2705R, 432 bp; “SC3”, SET_87F + CAN_2916R, 1096 bp. Lanes “D”: amplification from patient cDNA; lanes “B”: blanks (no cDNA). “L”, marker λ DNA/HinDIII digest; “123”, marker 123bp ladder (Invitrogen). (B) Partial sequence of the “SC2” PCR product showing in-frame fusion between TAF-I(SET) exon 7 (nt. 813 in GenBank accession NM_003011) and CAN exon 18 (nt. 2548 in GenBank accession NM_005085). Sequences corresponding to TAF-I( SET) exon 7 and to CAN exon 18 are underlined.

Figure 3.PCR amplification of the TAF-I(SET)/CAN genomic breakpoint. (A) Agarose gel electrophoresis. Patient DNA (lane “G”, 100 ng) was amplified using primers SET_747F and CAN_IN17_2R. Lane “B”, blank (no cDNA); lane “L”, λ DNA/HinDIII digest. (B) Partial sequence of the PCR product showing fusion between intron 7 of SET and intron 17 of CAN.

We demonstrate for the first time that a cryptic 9q34 interstitial deletion, which is easily detected by FISH using a commercially available probe for studying the t(9;22) (q34;q11)-BCR/ABL1, produces a TAF-I/CAN fusion gene. FISH, RT-PCR and genomic PCR were used to monitor our TAF-I/CAN positive AML, which responded partially to chemotherapy and was fully eradicated after hematopoietic stem cell transplantation from an HLA-identical sibling. Finding a cryptic del(9)(q34) as the genomic mechanism underlying a TAF-I/CAN fusion suggests that as long as only cytogenetics and PCR for known fusion proteins are used for genomic studies on AML the incidence of this rearrangement will remain unknown. FISH screening with the LSI BCR/ABL Dual Color, Single Fusion probe in 18 cases of AML with normal karyotype and no NPM1 exon 12 mutations did not detect any other cryptic del(9)(q) (data not shown). Moreover, array-CGH did not detect cryptic del(9)(q34) in AML/myelodysplastic syndrome with isolated trisomy 8 at a karyotypic level, or in CML.14,15

In AML, del(9)(q) are recurrent cytogenetic aberrations which, despite different boundaries, share a 2.4 Mb common deleted sequence at band 9q21.3. Molecular studies of the 11 putative suppressor genes which have been mapped within this region suggest a haploinsufficiency mechanism of one or more critical genes (1). In CML, cryptic del(9)(q34) at the translocation breakpoint of t(9;22) (q34;q11) includes the 5′ABL1 and has a variable extension towards the centromere. Interestingly, the largest deletions seem to have a poor prognostic significance, suggesting that loss of one or more tumor suppressor genes influences disease progression. 2 Cryptic deletions generating fusion genes have occasionally been described in hematologic malignancies. In a subgroup of T-cell acute lymphocytic leukemias the del(1)(p32), a 90 Kb sub-microscopic deletion, places the TAL1 gene under control of the SIL promoter.16 In 30–40% of chronic hypereosinophilic leukemias a del(4)(q12) of roughly 800 Kb generates the FIP1 L1A/PDGFRA fusion protein.17 In two cases of AML, cryptic 11q23 deletions juxtapose LARG or CBL genes with MLL.18,19

Although the chromosomal rearrangements underlying the TAF-I/CAN chimeric fusion are reported here for the first time, involvement of CAN and TAF genes has already been observed in hematologic malignancies. In young adults with AML, CAN was first identified as a partner of DEK in the reciprocal t(6;9)(p23;q34) which accounts for 2–3% of chromosomal rearrangements in AML.20 In one case of acute undifferentiated leukemia with normal karyotype, a variant of the DEK/CAN translocation i.e. the TAF-I/CAN fusion was reported with breakpoints in intron 17 of CAN and 800 bp 3′ of the TAF-I gene.21 Although genomic breakpoints were different in our patient, the same TAF-I/CAN fusion was formed as exon 7 of TAF-I was fused to exon 18 of CAN.

One major difference was TAF-I isoform involvement. The TAF-Iβ/CAN fusion protein, which was expressed in the case of acute undifferentiated leukemia binds hCRM1, disorganizes nuclear export, causes cell cycle arrest at S phase, partially blocks vitamin D3-induced differentiation and, like DEK/CAN, induces apoptosis in the U937 cell line.22–24 As our patient with AML-M4 expressed both TAF-Iα/CAN and TAF-Iβ/CAN transcripts, this is the first observation of TAF-Iα/CAN. Although the biological impact of TAF-Iα/CAN in the leukemogenic process remains to be established, concomitant occurrence of transcripts with both isoforms signifies molecular assays should assess each isoform transcript when monitoring the response to therapy of TAF1/CAN positive AML.

Acknowledgments

DNA clones were kindly provided by Dr. M. Rocchi (DAPEG, University of Bari, Italy). The authors wish to thank Dr. Geraldine Boyd for assistance in preparing the manuscript

Footnotes

• ↵* These two authors contributed equally to this work.
• Authors’ Contributions RR designed the molecular studies and wrote the paper. RLS designed FISH experiments and wrote the paper. GB and CM performed and interpreted array-CGH studies. PG perfomed molecular studies. VP, selected and validated DNA clones and performed FISH experiments. BC supervised FISH analyses. SR prepared cell cultures and performed cytogenetic analysis. GR perfomed mutational analysis. TA provided clinical data. FA, and MFM were involved in the management of the patient. CM was responsible for the conception and supervision of the study.
• Conflicts of Interest The authors reported no potential conflicts of interest.
• Funding: this work was supported by grants from MIUR (Ministero per l’Istruzione, l’Università e la Ricerca Scientifica), FIRC (Fondazione Italiana per la Ricerca sul Cancro, to B. C.) AIRC (Associazione Italiana Ricerca sul Cancro), FIRB (Fondo per gli Investimenti per la Ricerca di Base), Fondazione Cassa di Risparmio di Perugia, AULL (Association for the Study and Therapy of Leukemias and Lymphomas in Umbria), and Associazione “Sergio Luciani”, Fabriano, Italy.

• Received July 13, 2006.
• Accepted November 20, 2006.