First case of γ-thalassemia in association with a βS allele: a pitfall in the neonatal screening for sickle cell disease

Numerous deletional thalassemias have been reported so far, involving one or several globin genes in combination.1 A deletion specifically targeted on the fetal β-like genes was first described in 1983 and was characterized as a deletion-fusion removing the 3γ end of Gγ-gene and the 5γ end of Aγ-gene.2 This deletion was found after the identification of several newborns with an abnormally low Gγ/Aγ ratio, in the course of an Hb F expression study in newborns from various origins (Asian, European and African-American).3 This γ-gene deletion is clinically silent either in heterozygous or in homozygous conditions and was found in 1.42% of the tested newborns (mainly from China, India, Japan and the former Yugoslavia). In the present investigation, we have identified the first case of such a fetal γ-gene deletion found in association with a Sickle β-globin gene (βS).

Figure 1.β-globin locus analysis. (A) Isoelectrofocalisation from 1:the proband’s dried blood, 2: a normal newborn. (B) MLPA of the whole β-globin locus using the commercial kit from Xservices, the Netherlands (the arrow shows the probe located within the deletion). (C) Genomic Quantitative PCR with a set of primers located between G and Aγ genes (forward: aaatgtgtgtctttctggcctttt; reverse: ctgtgtaaagcttata); NTC: No Template Control. (D) Standard PCR with primers flanking Gγ and Aγ genes: Forward 5γacaagtgtctttactgcttttatttgct3γ and Reverse 5γccaaggtcatggatcgagtt3γ 1:Normal Control (no amplification); 2: Ladder 12kb (Invitrogen); 3: proband presenting a 3 kb amplicon.

The proband is a newborn screened at birth, in the course of the French neonatal screening program for Sickle Cell Disease (SCD). He was suspected of having SCD because of the presence of HbS and a very low level of HbA detected by IEF and HPLC, on a dry blood sample collected after three days of life (Figure 1A). At six weeks of age, control hemoglobin analysis on a venous blood sample revealed the following Hb rates: HbF 55%, HbS 27% and HbA 15% suggesting a compound heterozygosity for β-thalassemia and βS alleles. However, molecular analysis of the β-globin gene showed, as a single defect, heterozygosity for the prevalent sickle cell mutation transmitted by the father. The proband’s mother showed no Hb abnormality and normal red blood cell indices.

Nonetheless, the baby was included in the prevention program and a regular clinical follow-up was defined. At eight months of age, a control Hb analysis revealed a typical profile of βS heterozygote with Hb S: 35%, Hb A: 55% in contradiction with the neonatal diagnosis.

In an attempt to further explore this peculiar phenotype, the whole β-globin locus was analyzed by means of MLPA technical procedures (Xservices, the Netherlands) that allowed us to evidence a heterozygous deletion of the region localized between the fetal globin genes, Aγ and Gγ (Figure 1B). This deletion was confirmed by genomic qPCR (Applied Biosystem 7500) (Figure 1C) and by standard PCR (Figure 1D) through the amplification of an abnormal fragment 4.8 kb shorter than expected. The junction fragment was sequenced (Applied Biosystems 3130XL) and revealed the presence of a hybrid gene identical to Gγ-gene before the polymorphic TG repeat in IVS24 and identical to Aγ-gene after this repeat. As no abnormal sequence is created by the rearrangement, we assume that the breakpoint lies in this polymorphic sequence. The size of the deletion corresponds exactly to the size of DNA which separates the γ-genes (Figure 2). The hybrid gene produces an Aγ-globin chain under the control of the Gγ-gene promoter i.e. at a level normally seen for Gγ, explaining why the deletion is not symptomatic even in the homozygous condition. Such a deletion-fusion is also a common event occurring in α-globin locus: indeed, like the fetal γ-globin genes, α-globin genes present highly homologous flanking sequences which represent a potential target area for genetic rearrangements.5 The resulting deletions, called type 2 α-thalassemia deletions, are very frequent in Asians, Africans and Mediterraneans and cause no clinical consequences.

Figure 2.Schematic representation of the deletional γ-thalassemia in the β-globin locus; sequence co-ordinates: Gγ gene: 5232678-5230978, Ag 5227754-5226050.

Although we cannot confirm the presence of the deletion on the paternal chromosome which carries the βS allele, we hypothesize that the deletion is located in cis of the βS allele. Removing parts of the fetal coding region, it has led to premature interactions between LCR and the βS gene promoter, resulting in a high level of expression of the βS gene before birth. Thus, at birth, the proportion of HbS was higher than that of HbA, evocating SCD. In the weeks following birth, the switch on normal βA allele was processed, leading to the rise in the level of HbA, whereas the HbS level remained stable, and to the restoration of a typical heterozygous profile.

In conclusion, we show that a γ-thalassemia associated with a βS allele represents a pitfall in the neonatal screening for SCD.