Clonal origin tracing and integrated biomarker analysis in a JAK2V617F-positive essential thrombocythemia patient progressing to T-cell acute lymphoblastic leukemia

Transformation of Philadelphia chromosome-negative myeloproliferative neoplasms (MPN) into acute leukemia is a well-known but devastating complication that dramatically worsens prognosis.¹ The majority of such transformations result in acute myeloid leukemia (AML); secondary lymphoid transformation, particularly to T-cell acute lymphoblastic leukemia (T-ALL), remains exceptionally rare.² Only a few dozen such cases have been reported,³ and the molecular mechanisms underpinning lineage divergence remain poorly understood. Here, we describe a patient with JAK2^V617F-positive essential thrombocythemia (ET) who developed T-ALL within two years. Through integrative genomic, transcriptomic, and proteomic analyses, we identified independent myeloid and lymphoid clones arising from a shared clonal hematopoiesis background. This case highlights the biological complexity of MPN evolution and underscores the clinical importance of early genomic surveillance. The study was approved by the Institutional Ethics Committee of the Second Xiangya Hospital, Central South University (Approval No. LYEC2024-0082).

A 54-year-old man with a two-year history of JAK2^V617F -positive ET developed lymphadenopathy and systemic symptoms suggestive of malignant transformation. His ET had initially been characterized by increased megakaryocytes with atypical morphology and an elevated platelet count ranging from 732x10⁹/L to 1,351x10⁹/L. Treatment with intermittent α-interferon and aspirin maintained stable counts until two years after diagnosis, when the patient presented with oropharyngeal discomfort, cervical lymphadenopathy, and night sweats. Lymph node biopsy revealed a T-cell lymphoblastic lymphoma phenotype positive for CD3, CD5, and CD10, with a Ki-67 index of 50%.

On admission, PET-CT revealed multiple hypermetabolic cervical and supraclavicular lymph nodes (SUVmax 26.6). Bone marrow aspirate demonstrated hypercellularity with 62% lymphoblasts, confirming progression to T-ALL. Flow cytometry identified a dominant population (70.6%) of immature T lymphoblasts expressing CD5, CD7, cCD3, CD34, TdT, and CD38, consistent with T-ALL, while surface CD3, CD4, CD8, and MPO were negative. The JAK2^V617F mutant : wild-type ratio was elevated at 366%. The patient’s karyotype was normal 46, XY, and BCR-ABL1 transcripts were absent. The patient was treated with hyper-CVAD chemotherapy (cyclophosphamide, vincristine, doxorubicin, and dexamethasone) combined with ruxolitinib (10 mg twice daily). After one cycle, marrow blasts decreased from 62% to 20%.

Whole-exome sequencing (WES) showed the presence of DNMT3A mutations, suggesting underlying epigenetic dysregulation and potential sensitivity to hypomethylating agents. Therefore, we added azacitidine (100 mg/day, days 1-7) during the second cycle, which further reduced blasts to 17%. Following a third cycle incorporating high-dose methotrexate and cytarabine plus azacitidine, complete remission was achieved (4% blasts). Consolidation with VIDCP (bortezomib, cyclophosphamide, dexamethasone) was followed by haploidentical allogeneic hematopoietic stem cell transplantation (alloHSCT), resulting in durable remission. Comprehensive molecular profiling was undertaken to delineate the clonal origin of the neoplasm. WES identified pathogenic variants in DNMT3A, IKZF1, NOTCH1, and CSF3R, alongside JAK2^V617F. Specifically, IKZF1 p.Arg83*, DNMT3A p.Gly869Ser and splice-site mutation (c.855+2T>C), and CSF3R p.Thr618Ile and p.Lys785Ser*26 were detected. The variant allele frequencies (VAF) for DNMT3A and IKZF1 were approximately 25%, while JAK2^V617F showed a VAF of 13%. These results suggested co-existence of distinct myeloid and lymphoid mutational signatures.

To investigate lineage-specific origins, bone marrow mononuclear cells were fractionated by immunomagnetic sorting into CD7⁺ lymphoid, CD13⁺ myeloid, and CD7⁻CD13⁻ compartments. Sanger sequencing revealed that CD13⁺ myeloid cells harbored only JAK2^V617F, whereas CD7⁺ lymphoid cells carried DNMT3A, IKZF1 and CSF3R mutations but lacked JAK2^V617F (Figure 1A-F). In combination with WES, immunomagnetic sorting and longitudinal RNA sequencing demonstrated that the ET and T-ALL clones arose from independent progenitors, establishing clonal divergence rather than direct transformation.

Longitudinal RNA sequencing provided dynamic insight into clonal behavior. At diagnosis, transcripts associated with the T-ALL clone (IKZF1, DNMT3A, NOTCH1, and CSF3R) were abundant but declined markedly after chemotherapy, consistent with suppression of the lymphoid clone (Table 1). In contrast, JAK2 ^V617F transcript levels remained stable throughout treatment (23.85% at diagnosis; 16.36% after two cycles; 27.25% post remission) (Figure 1G), confirming persistence of the original myeloproliferative clone despite hematologic remission. This pattern suggests a competitive ‘seesaw’ model between co-existing myeloid and lymphoid clones, wherein therapeutic suppression of one population allows expansion of the other.

Western blot analysis elucidated the functional effects of therapy on signaling pathways. At baseline, JAK2, STAT3, and STAT5 were strongly phosphorylated, indicating constitutive JAK/STAT activation (Figure 1H). After two cycles of hyper-CVAD plus ruxolitinib, phosphorylated JAK2, STAT3, and STAT5 became undetectable, with further reductions in total protein levels following additional therapy. These findings confirmed effective biochemical suppression of the JAK/STAT pathway, although incomplete remission after early cycles suggested that pathway inhibition alone was insufficient to eradicate the dominant T-ALL clone.

The co-existence of JAK2^V617F-positive ET and subsequent T-ALL raises important questions about hematopoietic clonal evolution. Transformation of Philadelphia chromosome-negative myeloproliferative neoplasms typically results in AML,^1,4-7 while lymphoid transformation remains exceedingly rare.² A recent review identified only 31 such cases, with just 5 involving T-lineage leukemia.³ The rapid onset of T-ALL within two years in this patient contrasts with the median latency of nearly a decade reported in most series,^3,8 implying either pre-existing clonal hematopoiesis (CH) or selective pressure favoring lymphoid expansion.

Recent studies have increasingly implicated CH as a contributor to the development of secondary hematologic malignancies, including ALL. CH, defined by the expansion of hematopoietic stem/progenitor cells (HSPC) harboring somatic driver mutations, is a well-established precursor state for myeloid neoplasms but is now also being recognized in the context of lymphoid transformation.⁹ CH-associated mutations in genes such as DNMT3A, TP53, and other epigenetic regulators have been detected in individuals long before the onset of overt ALL, and these mutations can persist through therapy and relapse, suggesting a multipotent founder clone with lymphoid and myeloid potential.^10,11 In large adult ALL cohorts, CH-associated myeloid mutations were shown to predate ALL diagnosis by several years and were associated with persistent clonal signatures through remission and relapse, indicating that CH may provide a genetic substrate for leukemogenesis in the lymphoid lineage.¹⁰ Moreover, studies of patients with antecedent myeloid neoplasms have reported molecular evidence of CH clones contributing to divergent clonal evolution, whereby a shared pre-leukemic clone gives rise to distinct myeloid and lymphoid malignancies, including rare cases of secondary ALL after myeloproliferative neoplasms.³ These observations underscore the role of CH not only as a risk factor for hematologic malignancy broadly but also as a mechanistic link in the pathogenesis of secondary ALL arising from a pre-existing clonal hematopoietic architecture.

The mutational architecture in this case supports a model of parallel evolution from a shared hematopoietic progenitor. DNMT3A mutations (frequent in CH and T-ALL^12,13) likely arose early, establishing a pre-leukemic lymphoid-prone clone. The subsequent acquisition of IKZF1, NOTCH1 and CSF3R mutations may have driven full leukemic transformation, independent of the JAK2^V617F clone responsible for ET. This model aligns with recent reports showing that DNMT3A mutations often pre-date JAK2^V617F in myeloproliferative neoplasms and persist after secondary leukemia,¹⁴ implicating them as founder lesions within a shared progenitor compartment. The persistence of JAK2^V617F after T-ALL remission further supports its clonal independence.

The therapeutic implications are significant. Ruxolitinib effectively inhibited JAK/STAT phosphorylation but failed to eliminate the lymphoid clone, while the addition of azacitidine enhanced chemosensitivity, enabling remission. This suggests that epigenetic dysregulation via DNMT3A mutation may contribute to chemoresistance and that hypomethylating therapy can re-sensitize refractory lymphoid blasts. Ultimately, alloHSCT provided curative potential by eradicating both malignant clones. Given the poor prognosis of MPN-to-ALL transformation, early transplantation remains the most rational strategy for achieving durable remission. This case highlights the need to integrate molecular monitoring in MPN patients who develop atypical lymphoid features. Multilineage sequencing and transcriptomic tracking revealed two co-existing malignant populations with distinct origins (Figure 2). The dynamic interplay between these clones underscores the plasticity of CH and the importance of early genomic surveillance in identifying emergent leukemic evolution.

Table 1.RNA-seq analysis on the expression abundances of mutated genes before and after treatment in bone marrow.

In conclusion, T-ALL developing in a JAK2^V617F-positive ET patient arose from an independent lymphoid clone rather than direct transformation of the myeloproliferative clone. The co-existence of DNMT3A, IKZF1, and CSF3R mutations within the T-ALL population and persistence of JAK2^V617F expression in remission support a model of parallel clonal evolution from a shared pre-leukemic stem cell. Therapeutic suppression of JAK/STAT signaling with ruxolitinib and epigenetic reprogramming with azacitidine, followed by HSCT, achieved long-term remission. This case provides mechanistic insight into lymphoid transformation within a background of clonal hematopoiesis and reinforces the clinical value of integrative genomic analysis in myeloproliferative neoplasms.

Figure 1.Lineage-specific distribution of JAK2, IKZF1, DNMT3A, and CSF3R mutations and dynamic JAK-STAT pathway activation during treatment. Sanger sequencing results on isolated CD7⁺ or CD13⁺ or CD13- CD7- cells for JAK2, IKZF1, DNMT3A and CSF3R gene mutations (A-F). (A) JAK2^V617F mutation in CD13⁺ cells is positive but could not be found in CD7⁺ cells. (B) IKZF1 mutation (chr7:50444317 C>T) (hg19) was only detected in CD7⁺ cells. (C and D) DNMT3A mutations (chr2:25457282 C>T and chr2:25470904 A>G) were only found in CD7⁺ cells. (E and F) CSF3R mutations (chr1:36933434 G>A and chr1:36932116T>TGGGGCTGGGGGTGAGGCCCGCCAAGA) were only detected in CD7⁺ cells. (G) JAK2^V617F mutation detection in bone marrow before and after chemotherapy. Before C1: before first cycle chemotherapy (pre-treatment); Before C3: after second cycle of chemotherapy and before third cycle of chemotherapy; Before C4: before fourth cycle of chemotherapy. (H) JAK-STAT signaling pathway activation in serial bone marrow samples. C1: diagnostic sample (pre-treatment); C2: pre-cycle 2 (post-hyper-CVAD + ruxolitinib); C4: pre-cycle 4 chemotherapy; GAPDH: loading control; Health: healthy donor marrow; T-ALL: control sample from a JAK2^V617F-negative T-cell acute lymphoblastic leukemia patient.

Figure 2.Schematic diagram of essential thrombocythemia and T-cell acute lymphoblastic leukemia clone formation and independent evolution based on clonal hematopoiesis-variation trajectory of molecular markers before and after chemotherapy. 1. Clonal hematopoiesis originating from a DNMT3A mutation-driven cell population. 2. Following the first hit to these hematopoietic cells, a JAK2^V617F mutant subclone emerges (JAK2 mut (⁺) cells/DNMT3A mut (⁺) cells). 3. Upon a second hit to the DNMT3A mut (⁺) background cells, a dominant T-cell acute lymphoblastic leukemia (T-ALL) clone develops, characterized by molecular markers NOTCH1/IKZF1/CSF3R mutations. 4. After effective therapy, the dominant T-ALL clone regresses (evidenced by significant downregulation of NOTCH1/IKZF1/CSF3R expression), while the JAK2^V617F/DNMT3A mut (⁺) clone rebounds (showing up-regulated expression).

Footnotes

• Received October 25, 2025
• Accepted February 18, 2026

Correspondence

^#YZ and GZ contributed equally as senior authors

Y. ZHANG - yangzhang626@163.com

G. ZHANG - zgsllzy@163.com

Disclosures

No conflicts of interest to disclose.

Contributions

Funding

This work was supported by the National Natural Science Foundation of China (81470323 and 81500171), the Natural Science Foundation of Hunan Province (2019JJ40449, 2023JJ40850 and 2026JJ50077), and the Foundation of Health Commission of Hunan Province (D202303047052 and W20243031). The funder had no role in the study design, data collection, data analysis or data interpretation, or in writing the report.

Acknowledgments

We thank the patients, controlled individuals, and clinical teams who have been involved in the study.